noli

he/they


hi @yugioh hi @kaiba hi @kill

© 2026 Alterspring · About · Source code · Terms of Service · Privacy Policy
Ask something!

512

Your question has been sent.
Join Alterspring today! You'll be able to follow and ask people you know and a lot more.
Anonymous · 6mo

gTe

GCAGGTCGTGGGGTGTCATGGAGCCTCTGG Yup see that that's your dna I just doxxed your dna sequence

Hollow icon · 6mo

Hi noli hi noli hi noli hi nloi

hi hi hi hi hi hi hi hi hi hi hi hi hi who's your favorite mineslop story moder so far

Hollow icon · 6mo

At an art museum with a lot of Australian art and i remember how much your country is AWESOME!

Anonymous · 6mo

suicidebaiting using dandys world typing quirk is crazy

Anonymous · 6mo
: hey can you please not use your tp when u talk to me its pretty hard for me to read it (im dyslexic)

blot ou mimey: Ok . . . i only use it bc it helps ME read but wtv . . . i ' ll try . . . to not
use it as much . . . when i talk w / u , ok ? ( ・ε・)

. su tuoba , ] . . . . [ tuobA . erac I hcum woh s ' tahT . dneterp ] . . . . [ tel d ' I, laer t ' nsaw pihsdneirf eht fi nevE . evah syawla I . ti evresed I . niap eht ot desu ma I ? emas eht em staert enoyreve fi , erac yllaer I dluohs tub . . eromyna erac t ' nseod ] . . . . [ ekil tsomlA . emas eht em sees ] . . . . [ ekil leef regnol on I dna , kcen ym dnuora evah ot thgir saw ti ekil tlef syawla tl . ereht ni evah I epor eht gnikat dna tesolc ym otni gniog etabed I semitemos

Evil Impostor · 6 answers · 6mo

im a big fat trend hopper what do you associate with ME👀👀

Anonymous · 6mo

my  husband  two  bfdi  .  .  .   i  love  them  sm  !    (#^.^#)  i  hc  them  as  a  cis   aroace  like  me  .  .  .   I  '  m  so  sad   bc  one   is   such   a   bitch   to   them  .   disgusting   whore   leave   my   husband   alone  ( `Д´)/

Hollow icon · 6mo

I just woke up and didn't realize what this was and my heart dropped to my ass bruh

© 2026 Alterspring · About · Source code · Terms of Service · Privacy Policy

Alterspring uses Markdown for formatting

*italic text* for italic text

**bold text** for bold text

[link](https://example.com) for link