noli

he/they

hi @yugioh hi @kaiba hi @kill

© 2025 Alterspring · About · Source code · Terms of Service · Privacy Policy
Ask something!

512

Your question has been sent.
Join Alterspring today! You'll be able to follow and ask people you know and a lot more.
Answers 53 Questions
Anonymous · 27d

do you like Dandy's World

no.....sorry.....

@noli
noli · 27d
Anonymous · 27d

gTe

GCAGGTCGTGGGGTGTCATGGAGCCTCTGG Yup see that that's your dna I just doxxed your dna sequence

@noli
noli · 27d
@Yugioh
Nauseous Irontasting Heath · 27d

Hi noli hi noli hi noli hi nloi

hi hi hi hi hi hi hi hi hi hi hi hi hi who's your favorite mineslop story moder so far

@noli
noli · 27d
@Yugioh
Nauseous Irontasting Heath · 28d

At an art museum with a lot of Australian art and i remember how much your country is AWESOME!

Yayyy! Yayyyyyy! Thanks yugioh!

@noli
noli · 28d
@Yugioh
Nauseous Irontasting Heath · 28d

D-did you just send me anon hate

no...

@noli
noli · 28d
@bake
🧁🌷 · 1mo

https://alterspring.org/@noli/a/115619746482560635 IDK why He's speaking, he got Mad at This one User for Speaking weird and Told me to Hatemail them On Anon.

for Speaking Weird 🥹 he also lied and told me he could just Type Backwards for some reason. Like he could just Do That. put the reverse text generator down bruh

@noli
noli · 1mo
Anonymous · 1mo

suicidebaiting using dandys world typing quirk is crazy

god seriously it was because I didn't play roblox with her too

@noli
noli · 1mo
Anonymous · 1mo
: hey can you please not use your tp when u talk to me its pretty hard for me to read it (im dyslexic)

blot ou mimey: Ok . . . i only use it bc it helps ME read but wtv . . . i ' ll try . . . to not
use it as much . . . when i talk w / u , ok ? ( ・ε・)

. su tuoba , ] . . . . [ tuobA . erac I hcum woh s ' tahT . dneterp ] . . . . [ tel d ' I, laer t ' nsaw pihsdneirf eht fi nevE . evah syawla I . ti evresed I . niap eht ot desu ma I ? emas eht em staert enoyreve fi , erac yllaer I dluohs tub . . eromyna erac t ' nseod ] . . . . [ ekil tsomlA . emas eht em sees ] . . . . [ ekil leef regnol on I dna , kcen ym dnuora evah ot thgir saw ti ekil tlef syawla tl . ereht ni evah I epor eht gnikat dna tesolc ym otni gniog etabed I semitemos

@noli
noli · 1mo
@kill
ethan⠀♬ · 6 answers · 1mo

im a big fat trend hopper what do you associate with ME👀👀

among us obviously but also the.Earth ball guy Solarballs

@noli
noli · 1mo
Anonymous · 1mo

my　　husband　　two　　bfdi　　.　　.　　. 　　i　　love　　them　　sm　　!　　　　(#^.^#)　　i　　hc　　them　　as　　a　　cis 　　aroace　　like　　me　　.　　.　　.　　 I　　'　　m　　so　　sad 　　bc　　one 　　is　　 such 　　a 　　bitch　　 to 　　them　　. 　　disgusting 　　whore 　　leave 　　my　　 husband 　　alone　　( ｀Д´)/

PUT THE SPACES DOWN

@noli
noli · 1mo
© 2025 Alterspring · About · Source code · Terms of Service · Privacy Policy

Alterspring uses Markdown for formatting

*italic text* for italic text

**bold text** for bold text

[link](https://example.com) for link