noli

he/they


hi @yugioh hi @kaiba hi @kill

© 2026 Alterspring · About · Source code · Terms of Service · Privacy Policy
Ask something!

512

Your question has been sent.
Join Alterspring today! You'll be able to follow and ask people you know and a lot more.
Anonymous · 2mo

gTe

GCAGGTCGTGGGGTGTCATGGAGCCTCTGG Yup see that that's your dna I just doxxed your dna sequence

Reading Dick · 2mo

Hi noli hi noli hi noli hi nloi

hi hi hi hi hi hi hi hi hi hi hi hi hi who's your favorite mineslop story moder so far

Reading Dick · 2mo

At an art museum with a lot of Australian art and i remember how much your country is AWESOME!

ི˚̣̣̣† TaFFY · 3mo

https://alterspring.org/@noli/a/115619746482560635 IDK why He's speaking, he got Mad at This one User for Speaking weird and Told me to Hatemail them On Anon.

for Speaking Weird 🥹 he also lied and told me he could just Type Backwards for some reason. Like he could just Do That. put the reverse text generator down bruh

Anonymous · 3mo

suicidebaiting using dandys world typing quirk is crazy

Anonymous · 3mo
: hey can you please not use your tp when u talk to me its pretty hard for me to read it (im dyslexic)

blot ou mimey: Ok . . . i only use it bc it helps ME read but wtv . . . i ' ll try . . . to not
use it as much . . . when i talk w / u , ok ? ( ・ε・)

. su tuoba , ] . . . . [ tuobA . erac I hcum woh s ' tahT . dneterp ] . . . . [ tel d ' I, laer t ' nsaw pihsdneirf eht fi nevE . evah syawla I . ti evresed I . niap eht ot desu ma I ? emas eht em staert enoyreve fi , erac yllaer I dluohs tub . . eromyna erac t ' nseod ] . . . . [ ekil tsomlA . emas eht em sees ] . . . . [ ekil leef regnol on I dna , kcen ym dnuora evah ot thgir saw ti ekil tlef syawla tl . ereht ni evah I epor eht gnikat dna tesolc ym otni gniog etabed I semitemos

Evil Impostor · 6 answers · 3mo

im a big fat trend hopper what do you associate with ME👀👀

Anonymous · 3mo

my  husband  two  bfdi  .  .  .   i  love  them  sm  !    (#^.^#)  i  hc  them  as  a  cis   aroace  like  me  .  .  .   I  '  m  so  sad   bc  one   is   such   a   bitch   to   them  .   disgusting   whore   leave   my   husband   alone  ( `Д´)/

© 2026 Alterspring · About · Source code · Terms of Service · Privacy Policy

Alterspring uses Markdown for formatting

*italic text* for italic text

**bold text** for bold text

[link](https://example.com) for link